slc1a5 expression  (Genecopoeia)

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: SLC1A5 mediates glutamine transport required for lung cancer cell growth and survival

doi: 10.1158/1078-0432.CCR-12-2334

Figure Lengend Snippet: Table1

Article Snippet: Demographic and clinical characteristics of the 98 patients represented in both TMAs are summarized in , for details in IHC analysis refer to Supplementary materials . table ft1 table-wrap mode=article t1 Table1 caption a4 Characteristics of the patients in the TMAs cohort according to cancer status and SLC1A5 expression Cell culture Human lung cancer cell lines A549 (ADC), H1819 (ADC), HCC15 (SCC), H520 (SCC), and H727 (Carcinoid) (ATCC, Manassas, VA, USA) were maintained in RPMI-1640 medium (Gibco ® by Life Technologies, Grand Island, NY, USA) containing 10% heat-inactivated fetal bovine serum (FBS) (Gibco ® by Life Technologies, Grand Island, NY, USA), at 37°C, 100% humidity, and 5% CO 2 .

Techniques: Expressing

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Basic information on SLC1A5 across cancers. ( A ) Expression levels of SLC1A5 in normal and cancerous tissues. ( B ) Immunohistochemistry and HE staining of SLC1A5 in normal brain and glioma tissues. ( C ) Alteration frequency of SLC1A5 across cancers based on the cBioPortal database. ( D ) Immunofluorescence images of SLC1A5 protein expression in the nucleus, endoplasmic reticulum (ER), and microtubules in A-431 and U-251 cells. ( E ) The protein‒protein interaction (PPI) network shows the proteins interacting with SLC1A5.

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: Expressing, Immunohistochemistry, Staining, Immunofluorescence

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Correlation of SLC1A5 with single-cell classes in the pancancer microenvironment. ( A ) Heatmap showing the expression levels of SLC1A5 in 33 single cell types. ( B ) Scatterplot showing the GSE120575 dataset and the distribution of 10 different types of single cells. ( C ) Scatter plot showing the GSE131928 dataset and the distribution of 10 different types of single cells.

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: Expressing

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Correlation analysis between SLC1A5 and the prognosis of different cancer patients. ( A ) The summary of correlation analysis between SLC1A5 and patients’ overall survival (OS), disease-specific survival (DSS), disease-free interval (DFI) and progression-free interval (PFI) was analyzed by univariate Cox regression and Kaplan‒Meier. Red indicates that SLC1A5 is a risk factor for this type of cancer, and green indicates a protective factor. Only p values < 0.05 are shown. ( B ) Forest plot of the relationship between SLC1A5 and the prognosis of cancer patients analyzed by univariate Cox regression. Red markers indicate that SLC1A5 is a risk factor for this cancer type. ( C – F ) Kaplan‒Meier overall survival curves of SLC1A5 in LIHC ( C ), LGG ( D ), KIRC ( E ) and MESO ( F ).

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques:

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Gene set enrichment analysis (GSEA) of the SLC1A5 gene set across cancers. The size of the circle indicates the FDR value of the enriched element in each cancer, and the color indicates the normalized enrichment score (NES).

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques:

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Correlation of SLC1A5 expression with immune infiltration levels of B cells, CD4+ T cells, CD8+ T cells, dendritic cells, Endo, Eos, CAF, progenitor, mast cells, HSC, macrophages, monocytes, Tfh, γδT, NKT, regulatory T cells (Tregs), neutrophils, NK cells, and MDSCs in cancers. Red and blue indicate positive and negative correlations, respectively.

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: Expressing

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: Relationship between SLC1A5 and immunotherapy-independent efficacy predictive biomarkers. ( A ) The Spearman correlation heatmap shows that the expression level of SLC1A5 is correlated with 46 immunostimulators and 24 immunoinhibitors. Red indicates a positive correlation and blue indicates a negative correlation. ( B ) The relationship between SLC1A5 expression level and tumor mutation burden (TMB) in cancer patients. ( C ) The relationship between the SLC1A5 expression level and microsatellite instability (MSI) in cancer patients. The labeled asterisk indicates the statistical p value ( * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: Expressing, Mutagenesis, Labeling

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: In vitro evidence that SLC1A5 is involved in the proliferation and migration of glioma cells. ( A ) RNA and ( B ) protein expression levels of SLC1A5 in astrocytes and glioma cell lines. ( C – E ) RT‒qPCR and Western blotting verified the knockdown efficiency of SLC1A5 in U251 and U118 cell lines, respectively. ( F ) Colony formation experiments were performed to analyze the effect of SLC1A5 downregulation on the colony formation ability of U251 and U118 cell lines, and ( G , H ) statistical analysis was performed. ( I , J ) Cell proliferation ability was evaluated using the CCK-8 assay, and proliferation curves were plotted. ( K ) Cell migration ability was determined by transwell migration assay. The labeled asterisk indicates the statistical p value ( * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: In Vitro, Migration, Expressing, Western Blot, Knockdown, CCK-8 Assay, Transwell Migration Assay, Labeling

Journal: Aging (Albany NY)

Article Title: SLC1A5 is a novel biomarker associated with ferroptosis and the tumor microenvironment: a pancancer analysis

doi: 10.18632/aging.204911

Figure Lengend Snippet: SLC1A5 inhibits ferroptosis in glioma cells. ( A , B ) The level of GSH was measured in U251 and U118 cells after SLC1A5 knockdown. ( C , D ) The level of MDA was measured in U251 and U118 cells after SLC1A5 knockdown. ( E , F ) The RNA expression levels of the ferroptosis gene GPX4 were detected in U251 and U118 cell lines after SLC1A5 knockdown. ( G , H ) The RNA expression levels of the ferroptosis gene ACSL4 in U251 and U118 cell lines were detected after SLC1A5 knockdown. ( I ) Western blotting was used to detect the protein expression levels of GPX4 and ACSL4 after SLC1A5 knockdown. The labeled asterisk indicates the statistical p value ( * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: Human Protein Atlas (THPA, https://www.proteinatlas.org/ ) was used to detect SLC1A5 protein expression levels in pathological tissues and to confirm protein distribution at the subcellular level.

Techniques: Knockdown, RNA Expression, Western Blot, Expressing, Labeling

Journal: Thoracic Cancer

Article Title: Circ_0001273 downregulation inhibits the growth, migration and glutamine metabolism of esophageal cancer cells via targeting the miR ‐622/ SLC1A5 signaling axis

doi: 10.1111/1759-7714.14458

Figure Lengend Snippet: Primer sequences for quantitative real‐time PCR (qPCR)

Article Snippet: Mimic of miR‐622 (miR‐622, 5'‐ACAGCAGGCACAGACAGGCAGU‐3'), inhibitor of miR‐622 (anti‐miR‐622, 5'‐ACUGCCUGUCUGUGCCUGCUGU‐3') and their corresponding negative control (miR‐NC and anti‐miR‐NC, 5'‐UUCUCCGAACGUGUCACGUTT‐3' and 5'‐CAGUACUUUUGUGUAGUACAA‐3') were directly purchased from Ribobio. pcDNA expression vector was used for SLC1A5 overexpression, and fusion pcDNA‐SLC1A5 vector (SLC1A5) and pcDNA empty vector control (pcDNA) were provided by Genepharma.

Techniques: Real-time Polymerase Chain Reaction

Journal: Thoracic Cancer

Article Title: Circ_0001273 downregulation inhibits the growth, migration and glutamine metabolism of esophageal cancer cells via targeting the miR ‐622/ SLC1A5 signaling axis

doi: 10.1111/1759-7714.14458

Figure Lengend Snippet: SLC1A5 was a target of miR‐622. (a) The binding site between SLC1A5 and miR‐622 was predicted by TargetScan. (b, c) The predicted binding site between SLC1A5 3'UTR and miR‐622 was validated by dual‐luciferase reporter assay. (d) The expression of SLC1A5 mRNA in tumor tissues and normal tissues was measured by qPCR. (e) The correlation between SLC1A5 expression and miR‐622 expression in tumor tissues. (f) The expression of SLC1A5 protein in tumor tissues and normal tissues was detected by Western blot. (g) The expression of SLC1A5 protein in HEEC, TE1 and ECA109 cells was detected by Western blot. ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: Mimic of miR‐622 (miR‐622, 5'‐ACAGCAGGCACAGACAGGCAGU‐3'), inhibitor of miR‐622 (anti‐miR‐622, 5'‐ACUGCCUGUCUGUGCCUGCUGU‐3') and their corresponding negative control (miR‐NC and anti‐miR‐NC, 5'‐UUCUCCGAACGUGUCACGUTT‐3' and 5'‐CAGUACUUUUGUGUAGUACAA‐3') were directly purchased from Ribobio. pcDNA expression vector was used for SLC1A5 overexpression, and fusion pcDNA‐SLC1A5 vector (SLC1A5) and pcDNA empty vector control (pcDNA) were provided by Genepharma.

Techniques: Binding Assay, Luciferase, Reporter Assay, Expressing, Western Blot

Journal: Thoracic Cancer

Article Title: Circ_0001273 downregulation inhibits the growth, migration and glutamine metabolism of esophageal cancer cells via targeting the miR ‐622/ SLC1A5 signaling axis

doi: 10.1111/1759-7714.14458

Figure Lengend Snippet: SLC1A5 overexpression reversed the effects of miR‐622 enrichment. In TE1 and ECA109 cells transfected with miR‐622 alone or miR‐622 + SLC1A5, (a) the expression of SLC1A5 protein was measured by Western blot. (b–d) Cell proliferation was determined by cell counting kit‐8 (CCK‐8), EdU and colony formation assays. (e) Cell apoptosis was ascertained by flow cytometry assay. (f) Cell migration was determined by wound healing assay. (g, h) The expression levels of E‐cadherin and N‐cadherin were measured by Western blot. (i, j) Glutamine consumption and glutamate production was determined by using matched kits. (k) The expression of SLC1A5 protein in TE1 and ECA109 cells transfected with sh‐circ_0001273 or sh‐circ_0001273 + anti‐miR‐622 was measured by Western blot. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Article Snippet: Mimic of miR‐622 (miR‐622, 5'‐ACAGCAGGCACAGACAGGCAGU‐3'), inhibitor of miR‐622 (anti‐miR‐622, 5'‐ACUGCCUGUCUGUGCCUGCUGU‐3') and their corresponding negative control (miR‐NC and anti‐miR‐NC, 5'‐UUCUCCGAACGUGUCACGUTT‐3' and 5'‐CAGUACUUUUGUGUAGUACAA‐3') were directly purchased from Ribobio. pcDNA expression vector was used for SLC1A5 overexpression, and fusion pcDNA‐SLC1A5 vector (SLC1A5) and pcDNA empty vector control (pcDNA) were provided by Genepharma.

Techniques: Over Expression, Transfection, Expressing, Western Blot, Cell Counting, CCK-8 Assay, Flow Cytometry, Migration, Wound Healing Assay

Journal: Thoracic Cancer

Article Title: Circ_0001273 downregulation inhibits the growth, migration and glutamine metabolism of esophageal cancer cells via targeting the miR ‐622/ SLC1A5 signaling axis

doi: 10.1111/1759-7714.14458

Figure Lengend Snippet: Circ_0001273 knockdown suppressed tumor growth in vivo. (a, b) Tumor volume and tumor weight were measured to assess tumor growth. (c, d) The expression of circ_0001273 and miR‐622 in the excised tumor tissues was detected by qPCR. (e) The expression of SLC1A5 protein in the excised tumor tissues was detected by Western blot. (f) The abundance of E‐cadherin, N‐cadherin, Ki67 and SLC1A5 in the excised tumor tissues was determined by immunohistochemistry (IHC) assay. ** p < 0.01; **** p < 0.0001.

Article Snippet: Mimic of miR‐622 (miR‐622, 5'‐ACAGCAGGCACAGACAGGCAGU‐3'), inhibitor of miR‐622 (anti‐miR‐622, 5'‐ACUGCCUGUCUGUGCCUGCUGU‐3') and their corresponding negative control (miR‐NC and anti‐miR‐NC, 5'‐UUCUCCGAACGUGUCACGUTT‐3' and 5'‐CAGUACUUUUGUGUAGUACAA‐3') were directly purchased from Ribobio. pcDNA expression vector was used for SLC1A5 overexpression, and fusion pcDNA‐SLC1A5 vector (SLC1A5) and pcDNA empty vector control (pcDNA) were provided by Genepharma.

Techniques: In Vivo, Expressing, Western Blot, Immunohistochemistry